The end of Internet (browsers, and search engines at least!)

by Taoffi Nassar 4. February 2012 21:14

Communication is a vast and ancient field which ran through many evolution phases, experiments and research. Internet, as we know it today, is one of the outcomes of this human work.

In this story, no one technology proved eternal or ever-lasting. Cycles of evolution produced some usable and convenient forms of communication at a time. Internet seems to be just one of these.

But now, each time I look at a web page, I feel that just cannot last much longer (at least I hope so:)): these elastic regions, shapeless tables, unexpected fonts changes, images and colors… hazardous page reloads and other ‘partial updates’ (sometimes even more annoying)… the whole mess of plug-ins, add-ins and other artifacts…

That really doesn’t seem to be an ever-lasting model!

Searching for something on Internet is even worse. Just go search for the word ‘sequence’ and you will find yourself with a non-classified mess of subjects ranging from cinema to molecular biology!

Looking for a solution of a problem?... you may find many, often ten or fifteen years old… which rarely relates to you current question.

To keep some ‘Lasting Value’ for old archived articles, many publishers no more mention the articles’ publication date… and search engines don’t help much in finding out a time-classification of a search result. All these ‘partners’ (publishers / search engines) are happy with this. As long as the consumer (you and I) don’t complain, the business just continue to run with minimal costs!

The appropriateness between what is needed and what is offered seems to be near a break-point.

In parallel, the great rise of technologies like web services and the wide range of their implementations may just allow us to hope for something new to emerge: new stable and appealing content explorers / new relevant and coherent search engines.

ShrekPoint

by Taoffi Nassar 12. January 2012 20:25
shrek With a little refactoring, this presentation can be quite good for SharePoint 2010:

“In this fully computer-animated fantasy from the creators of Antz, we follow the travails of Shrek […], a green ogre who enjoys a life of solitude. Living in a faraway swamp, he is suddenly invaded by a hoard of fairy tale characters, such as the Big Bad Wolf, the Three Little Pigs, and Three Blind Mice, all refugees of their homes who have been shunned by the evil Lord Farquaad […]. They want to save their homes from ruin, and enlist the help of Shrek, who is in the same situation…”

 

“While simultaneously embracing and subverting fairy tales, the irreverent Shrek also manages to tweak Disney's nose, provide a moral message to children, and offer viewers a funny, fast-paced ride.”

 

Back to earth: DBNull and ConetxtMenuStrip target TreeView node

by Taoffi Nassar 29. July 2011 06:21

 

It is time now to set concepts aside for some more practical problems!

Last days, through the work on two different projects, I encountered DBNull twice, and faced a funny problem about locating the target TreeNode of a contextual menu!

Let us start by the first one:

DBNull in Silverlight and Windows Forms

I encountered a DBNull problem two times (in three days… that seems a bit much). The first time was in the context of a WCF service intended to feed a Silverlight application, and the second was in the context of a GridView control in a Windows Forms application.
For your information, DBNull is a .NET Type defined in namespace System (mscorlib.dll).

The first issue emerged with what appeared to be a communication problem between a Silverlight application and one related WCF service. After some research, DBNull was reported to be an unknown Type in XML serialization. The service was transmitting data read through a SQL Server database… We had a Cell class. Its Data member was an object.
A bit more research made it visible that the following code as the source of the annoyance:

cell.Data = data_reader.GetValue(cell_index)

 

In fact, when the field at cell_index was null, data_reader.GetValue() returned DBNull. Which was assigned as the cell’s Data. Serialized by WCF, DBNull was not recognized by the receiving Silverlight application.

Though the time needed to discover the source of the problem was quite long, the solution was quite simple:

 

cell.Data = data_reader.IsDBNull(cell_index)

                  ? null :data_reader.GetValue(cell_index)

// Which clearly means:

if(data_reader.IsDBNull(cell_index))

    cell.Data = null;

else

    cell.Data = data_reader.GetValue(cell_index)

Now that the cell content is null, everything goes right (because null is a recognize Type).
It will be a great day when DBNull (which implements the ISerializable Interface) will simply be serialized as null… let us just wait.

Yet another DBNull problem!

Once the Silverlight DBNull problem solved… precisely: the next day J, I just found myself again confronted by another DBNull. This time in a Windows Forms application.
In this new case, I had a DataGridView control which was filled using a DataTable and I wanted to programmatically add a row to those displayed in the DataGridView control.
Obtaining the row’s data was simple (calling a web service or by directly querying a database).
The task was then to add the obtained data as a new row of the DataTable used as the source of the control. The problem was again related to the cells containing null values in the new added row.

In fact, if you assign the row’s cells data through a DataRow object you may not have a particular issue. Issues appear when you try to assign an object’s properties values to the row cells.

In this particular case, we had an object with some properties of nullable types: for instance int?  parent_id. The code below generated an error:

DataRow row = table.NewRow()

row["parent_id"] = obj.parent_id;  // an error here when obj.parent_id == null

Some solutions are proposed in several forums. They mainly propose to handle some special events of the DataGridView (like DataError event) and/or play with custom interpretation of DBNull…
The solution I used seems more simple. It is based on the fact that when the row was created (using table.NewRow() method) it contained all required cells… each of which, a priori, filled with something (a sort of ‘null’ thing… we don’t really care about its type). So, we simply may assign cell values only if the data to be assigned is NOT null:

DataRow row = table.NewRow()

if( obj.parent_id != null)

       row["parent_id"] = obj.parent_id;

That seems to work!

Contextual menus… yes! but where is the target node?

TreeView control is a nice and useful control to show many data domains.
One nice and efficient thing of TreeView control is that it allows the developer to handle many aspects of tree nodes by their level in the tree hierarchy. You can for instance choose the icon of items according to their nest level in the tree hierarchy
Among the customizations you can do is to choose a specific contextual menu for each hierarchy level… very cool and simple to do.
When the user right clicks a node in the tree, he or she would see the assigned contextual menu and be able to execute operations in relation to the type of the node.
The thing is, when a menu is clicked, you developer should find out which node was selected when this menu was clicked… Curiously, this is not as simple as we may expect.

I naively thought, a contextual menu object will contain some relevant information about its Target object (in our case: the target Node)… unfortunately this was not true!
So, you simply find yourself with a command to execute (the menu clicked)… but don’t know on which object of the tree should you execute this command!
Few solutions are proposed to solve this problem, and none, of what I read, seemed sustainable.
Here again, we should ‘reinvent the wheel’…

Reinventing the contextual wheel!

The problem seems to be: “Locating the target tree node”. The problem’s definition starts by “Locate”… so let us think “location”.
I first started by trying to locate the mouse cursor at the moment of the click event (using MousePosition which returns the point of the current mouse position in screen coordinates)… but that seemed random, not always related to the node position (and also quite difficult to debugJ).
The next step was to think “location of controls”.
In fact, a contextual menu is a control and as such, it should have a location… hopefully relative to its parent control (which is the TreeView).
Our Click event is received from a contextual menu item (ContextMenuStrip object) which is located into a parent control (the contextual menu box), itself is a child control of the TreeView control containing the node.
The following figure illustrates this disposition 

 

The Owner property of the menu strip contains its parent menu control information. Through this information, we are able to obtain the location of the menu box, and thus, the location  of the first menu strip relative to the TreeView control. With some more simple arithmetic, we can finally locate the right-clicked node (the target node) using the TreeView control GetNodeAt(Point point) method :

 

 

static TreeNode LocateContextMenuTargetNode(

             TreeView            tree_view,

             ToolStripMenuItem   menu_item)

{

       // check entries

       if( tree_view == null || menu_item == null || menu_item.Owner == null)

             return null;

 

       ToolStrip           menu  = menu_item.Owner;

       // top most menu item

       ToolStripMenuItem   first = (ToolStripMenuItem) menu.Items[0];

 

       // obtain the enclosing rectangle of the menu box

       Rectangle           menu_rect   = menu.RectangleToScreen(menu.ClientRectangle);

       // obtain the rectangle relative to the TreeView control

       Rectangle           tv_rect     = tree_view.RectangleToClient(menu_rect);

       // obtain the optimal point that corresponds to the right-clicked node

       Point               point       = newPoint(

                                    first.ContentRectangle.X + tv_rect.X,

                                    first.ContentRectangle.Y + tv_rect.Y);

 

       // finally, get the right-clicked node

       return tree_view.GetNodeAt(point);

 

}

 

 That works fine for contextual menus with few elements and in a ‘normal’ screen resolution.
If the contextual menu contains many items, the first item may be quite far away from the target node!...So, what?
Let us look for a more sustainable way to locate our item… we may again, rethink ‘mouse location’!

In this solution, we will keep track of the current ‘right-clicked node by responding to the MouseDown event of the TreeView.


TreeNode     m_context_menu_target_node; 

void treeView1_MouseDown(object sender, MouseEventArgs e)
{
    // if this is not a right-click: do nothing
    if (e.Button != System.Windows.Forms.MouseButtons.Right)
    {
        m_context_menu_target_node = null;
        return;
    }
 
    Point point = e.Location;

    m_context_menu_target_node = treeView1.GetNodeAt(point);
}

 

Now, when a contextual menu is clicked, we can first see if the target node is not null… execute the command and reset the target node to null (until the next time): 

 
       TreeNode node = m_context_menu_target_node;

       if (node == null)
             return;

       // reset the target node to null
       m_context_menu_target_node = null; 

       // execute the command on the node
      
 

 

Meta models… what is it and how can it be useful (for you)

by Taoffi Nassar 10. July 2011 03:22

 

I spent a long time during the last months writing about meta-models. That was in the context of a book for Editions ENI (France) about some concepts to which I dedicated some work since quite a while (it was around 1998, as long as I remember, that I started studying the basis of the approach).

 

In previous posts (see, for instance, Silverlight database to DataGrid, yet another approach- Part II) I exposed a generic approach for describing database meta-data. The direct practical purpose of those posts was reading and displaying data into Silverlight DataGrid. Through this exercise, we also saw how can our structures help us in integrating business rules at several level (meta-column, meta-table… and so on).

 

In this same exercise, applying the meta-models approach would consist of persisting these structures into the database… to read and create them dynamically.

 

We would, for instance, store our meta-columns / meta-tables definitions into the database and let our software objects load these structures and transform them into ‘live’ data, integrating all defined business and technical constraints.

 

 

 

What are meta-models?

 

I use the term "meta-model" to designate "a description of a description" stored in a database and interpreted (read and presented) by one or more (specific) software objects (classes).

 

That is: the information stored in the database describes an object or a behavior, and the software class that reads this information is aware of the fundamental semantics of this information and is, thus, able to interpret it independently of a particular context.

 

This means that, according to our view, a meta-model is composed of:

 

§  Database objects and structures to store the model's data;

 

§  Software (kernel) objects that know the fundamental semantics of the database model.

 

 

 

The collaborative aspect between the 'description' stored in the database and the 'runtime object' (which reads and interprets that description) is essential for this approach to be applicable.

 

 

 

Why use meta-models?

 

Let us take a sample application where the software should display a page (or form) composed of a Master / Detail connected regions… i.e. a list of items in a Master grid, with a Detail form that displays the details of the item selected in the Master grid.

 

That 'Master/Detail’ layout may be the software application's approach for presenting the information of several entities. The application developer may choose to create a specific page for each manipulated entity… a choice which may be correct in some contexts, but which also remains questionable by its repetitive approach.

 

 

 

In another, more automated, approach, the software developer may prepare templates for each entity's specific Master/Detail information, and load the required template according to the context's entity.

 

This latest approach would be a first step for a meta-modeling approach for entities' presentation.

 

 

 

In fact, storing these templates as part of software objects would make them dependent of their related objects' compiled state. That is: the template cannot evolve without changing and recompiling related objects' code. Storing template's information in a database (meta-model) would circumvent this inconvenience.

 

In the same time, storing templates' information in a database would also require a (more or less important) change in software object's structure and behavior. Using a database meta-model approach (to describe Master/Detail templates in our case), requires the software object to act in a more abstract way. And this is what we called 'collaborative' approach (between database meta-model and runtime objects).

 

 

 

Finally, in the long run, our software object would constitute a 'kernel object' capable of displaying and handling any entity's Master/Detail information stored in a database meta-model.

 

 

 

What can we do with meta-models?

 

The sample exposed above can of course be extended to more elaborate models and interactions between descriptions stored in a database and their software objects' counterpart.

 

Let us again take another practical sample: an application that may need to normalize the appearance of asp.net data grid controls.

 

We know that a GridView control contains some appearance properties like:

 

§  Width;

 

§  HeaderStyle-CssClass;

 

§  AlternatingRowStyle-BackColor;

 

§  … etc.

 

 

 

We may choose to use the database to store values for each of these properties and let our software objects assign these values to each DataGrid (on the page's load event for instance).

 

Now, to handle the appearance of our GridView controls, we just need to assign new values for these properties in the database. A task which requires less effort, less time and fewer technical skills.

 

 

 

Meta-models and Reflection

 

Reflection is the process of introspection (self-examining) of the internal structures of software objects at runtime. .NET implements Reflection in some classes defined in the System.Reflection namespace.

 

 

 

Our previous exercise can be extended to more abstract and useful applications.

 

In fact, a software object (like GridView in the last sample) has properties to which we can dynamically assign values if we may simply know their name:

 

 

 

 

PropertyInfo property = Type.GetProperties().FirstOrDefault(

                            p => string.Compare( p.Name, my_name) == 0);

 

 

 

 

After locating the property inside the specified object's Type (class) we may assign it a specified value:

 

 

 

 

property.SetValue( … )

 

 

 

 

Our meta-model may make use of Reflection mechanisms to store property names and values in the database, to read and assign the specified values to the specified objects at runtime.

 

 

 

This approach may be of interest in many software applications. Its main advantages are, again:

 

§  More adaptable and versatile software;

 

§  Reducing development and maintenance efforts, time and cost!

 

 

 

Meta-models and method invocation

 

What we explained above about using System.Reflection to discover an object's property by name and assign a value to the retrieved property, is also applicable to methods:

 

 

 

 

MethodInfo method = Type.GetMethods().FirstOrDefault(

                            m => string.Compare( m.Name, my_name) == 0);

 

method.Invoke( … )

 

 

 

 

On the other side, user interface’s command elements like Menus, buttons… are often associated with an event handler that represents the entry point for the action of the command.

 

 

 

To explain how a meta-model can be useful in this area, let us take an example of an update button.

 

An update button collects the user entries into the form fields, checks their integrity and submits them to the server for updating the specified table;

 

Having the meta-data and business rule constraints for the columns of the entity, this update operation can be handled through one same handler. Or be handled by a dynamically selected handler specific to the context.

 

So, we know that a data entry form would have an update button. And we may need to assign a specific method as the handler of the Click event for this button.

 

All these required information elements can be stored into a database meta-model. The meta-model software would then:

 

§  Read (or otherwise find) the name of the method assigned as handler of the button's action event;

 

§  Dynamically locate the method in the software (loading the assembly when required);

 

§  Invoke the method.

 

 

 

Again, this meta-model solution can be applied on different contexts (records submission, web service operations invocation… etc.) and/or on different objects or controls (buttons, menus… etc.).

 

 

 

Interoperability and Integration

 

The database meta-model approach may also be used in a way similar to what we already use in Interop assemblies (which create links between 'unmanaged / native' code end 'managed code').

 

A meta-model-aware assembly method may, for instance, prepare entries to methods that reside in non-meta-model-aware assemblies or methods.

 

Such methods can also be defined in different projects independent of the 'meta-model-kernel' assembly. And may, thus, allow a high level integration of existing applications (or data) into the meta-model solution.

 

 

 

Extensibility

 

As we said above, the meta-model as exposed in this paper, is a collaborative ensemble where the database descriptions are tightly connected to the meta-model kernel software.

 

Two more questions though:

 

§  What about the evolution of the meta-model's own kernel?

 

§  How to describe objects that we don't yet know about?

 

 

 

Here comes another important point which seems to represent a good basis for answering the above questions:

 

§  An object is represented by a set of properties;

 

§  A property is, essentially, a definition composed of

 

·         A Name

 

·         And an Attribute (the Attribute defines property's constraints: mainly 'Data Type');

 

§  A Value can be assigned to a property in the context of either a class (static property) or to an instance of this class. (Note: Value should conform to the attribute's constraints).

 

 

 

So we may consider the data of an object as a collection of (Property / Value)… i.e. a collection of ((Name/attribute)/Value).

 

This seems to be, more or less easily, presented in a meta-model, which may allow us to handle future 'unknown objects' or future unknown 'properties'.

 

 

 

Meta-models self-describing

 

On one hand, meta-models are data stored in a database… and on the other, they are extensible. Managing them can also be described by meta-models. This recursive aspect can be of interest to some applications to allow users to autonomously manage software semantic behaviors without the need of extensive technical knowledge.

 

Learning from Nature: Towards a Nucleotidic modeling - part II

by Taoffi Nassar 26. March 2011 23:25

Two days ago, my friend Olivier Vallée sent me an article (nytimes) talking about the emerging role of software tools in reducing costs of lawyers’ work by analyzing documents contents. This reminded me the work we did, Olivier and I, some years ago around the use of a nucleotidic approach for analyzing textual data.

 

So, here again to continue the subject of the earlier post!

 

In part I, I presented a first view of the analogies between molecular biology elements and other real world problematic. And a probable benefit of using molecular biology’s structures and be behaviors to in data modeling and software solutions architecture.

In this part, I will try to expose a simple and direct application of this approach: language modeling and analysis. There are several advantages for starting with textual analysis as a first application:

·         First, a textual object structure can easily, and somehow directly, be mapped to molecular biology elements (nucleotides, DNA strands, amino acids…);

·         Second, the textual analysis is becoming (re-becoming!) a must know (and probably lucrative as well J) technology  (see nytimes article);

Let us first try to analyze the physical (organic) structure of a textual object:

·         Characters;

·         Composing Words;

·         Composing phrases;

·         Composing paragraphs;

·         … etc;

 

This same physical structure can be interpreted according to other (different / parallel) logical  components:

·         Symbols (óCharacters);

·         Composing phonemes (ówords);

·         Composing expressions;

·         Composing sense (social / intellectual orientation (or mood) of the text)

 

Again, this parallel presentation of a same object (encountered in so many data modeling problematics) is one of the important analogies with molecular biology elements (i.e. similar, for example, to nucleotide sequences mapping to amino acids).

To illustrate another aspect of this analogy, let us take a look at the characters / words ó characters / phonemes parallel. To correctly read a phoneme, we need to locate its start-end characters. Which may overlap or be part of the ‘Words’ sequence of our text. In some way, we need to retrieve the reading frame (or phasing) of a sequence of phonemes through our nucleotidic characters structure. This phasing is independent of the characters/words sequence presentation. Which, again, brings to our mind the question of reading frames of an amino acid sequence contained in a nucleotidic sequence.

 

In the case of our text sequence question, characters, words, phonemes… etc. are, of course, language-dependent. However, for sake of simplicity, let us stay in the context of the English language.

 

Let us now take an example of how we can read a ‘mood’ sequence inside a physical text sequence (characters, words…) sequence.

The mood (social sense) of a text can be detected through the interpretation (or translation) of specific (predefined) expressions sequence(s).

For example:

“That’s great” can be interpreted differently from “hey… fantastic”

Or “Hello”, differently from “Hi”…

Or “L” differently from “J

… etc.

 

Social expression of a text sequence is also, in some way, related to its internal phoneme sequence. Text phonemes actually produce a sequence of sounds that give a particular internal ‘music’ to the text. Which participates, in the end, in transmitting the specific social sense of the initial text sequence. That is probably an important aspect of poetry (?)

 

I will provide a practical coded example in a future post.

JAN 25… "Those stone-age men setting in chairs"

by Taoffi Nassar 21. February 2011 03:16

Egypt’s January 25 revolution is a great hope for humanity.

Against a regime of criminals with 1.8 million of “well-equipped” and “well-trained” anti-riot forces… and some more thugs, opportunists and other hypocrites… young peaceful people with human values could win.

We are living a new dawn for human values.

Happy new year, Stephane Hessel

by Taoffi Nassar 21. December 2010 04:19

A new year is here… and this reminds me of Stephane Hessel, a young man born in 1917.

After having fought against the Nazis in World War II, he still keeps teaching us so many (simple) principles of humanity... still offers us a fresh and critique view of the True and False wellbeing of our ‘modern model’ of civilization… inviting us to prefer human values against established laws, and to keep our indignation in front of ‘financial market dictatorship’. (Read this interview)

 

Happy New Year Stephane Hessel… we will try harder!

 

Pour nos amis francophones :

·         Stéphane Hessel sur Wikipédia FR…

·         Lire la présentation de son livre ‘Indignez-vous’ !

Political pause: Challenges à la Française

by Taoffi Nassar 12. November 2010 17:31

Dans un des derniers numéros, Fortune prend comme sujet « 40 under 40 » pour parler de 40 (ça nous change des chiffres 50 et 500 J) jeunes personnalités.

Parmi ces 40 personnalités, on trouve Esther Duflo, économiste d’origine française, actuellement professeur au Massachusetts Institute of Technology (MIT) où elle détient la « chaire Abdul Latif Jameel sur la réduction de la pauvreté et l'économie du développement ».

Cela m’a fait plaisir de savoir que la France avait encore à donner au monde quelque chose de différent à la fois de Sarkozy et de BHL !

Quelques semaines plus tard, c’est dans le magazine français Challenges que je suis tombé sur ce gentil commentaire à propos du même sujet :

« … cette sélection des "40 under 40" très ouverte aux non-Américains. Mais quel Français parmi ces 40 visages ? L’économiste Esther Duflo, professeur au MIT, experte de la mesure de l’efficacité des programmes anti pauvreté. Comme si la France avait fait de la misère son domaine de compétence… »

 

Très aimable !

 

Bizarrement, le numéro suivant de ce même magazine, consacre des pages et des pages à un autre genre de under 40 : Pierre Kosciusko-Morizet.

Né en 1977, ce jeune homme a apparemment fait un gros coup qui vaut le détour : créer une boîte (française donc : priceminister) pour la revendre dernièrement (pour pas mal d’argent… c’est le sens du succès) à une boîte Japonaise…

Là apparemment on n’est pas dans la misère (selon à travers de quel trou on regarde la scène !)

 

Learning from Nature: Towards a 'Nucleotidic' modeling - part I

by Taoffi Nassar 19. September 2010 00:05

 

 

 

During several years, I worked on a DNA sequence-analysis software project where I learned about DNA structures and several DNA engineering techniques.

(That is not to be confused with what is commonly called ‘genetic algorithms’ and ‘genetic programming’).

 

Elements and structures used (and manipulated) in molecular biology engineering sphere are fascinating and, above all, source of interesting knowledge. In some way, they define the representation of ‘Life hood’ structures and mechanisms for every living creature (plant, animal, bacteria, virus…)

Molecular biology teaches us that ‘Life’ is based on few nucleotides: A, T, G and C.

Like in music partitions, sequences composed of these few number of nucleotides can give unlimited number of combinations each representing the structure of a specific biological function and, in the end, a specific individual being.

 

Here are some sample (random) fragments of DNA sequences:

 

3’à…GCAATGGTTTCTTACTGTGGAGGACATAAAAATACAGCAAGGGT…à5’

3’à…TTGTGTTGCGAGATGTCGTCGTTAAAGACACTCTTTCTCCCGGAGTCAC…à5’

3’à…CTCTACAGTATAAAGTTCTAGTAAGAGCACAAACTCCTGGACAATTC…à5’

 

Note that DNA sequences are read in a specified direction (noted 3’à5’ in the above sequences).

Nucleotides are considered in complementary (attracted) pairs. A is complementary to T, and G to C.

Each DNA sequence strand has a ‘complementary’ sequence strand where complementary nucleotide pairs are arranged face-to-face in reversed direction to compose part of the well-known helicoidal presentation.

 

Example:

The complementary strand for

3’à…GCAATGGTTTCTTà5’

Is

5’ß…CGTTACCAAAGAAß3’

 

A DNA sequence has its mapped amino acid (protein) sequence. In this mapping, different combinations of three nucleotides (A, T, G or C) compose codons, each mapped to one amino acid (one amino acid may have several codon mappings… see below).

Here are some codon/amino acid mappings:

 

Amino acid

Amino acid Symbol

Codon

Alanine

A

GCA

GCC

GCG

GCT

Arginine

R

AGA

AGG

CGA

CGC

CGG

CGT

Asparagine

N

AAC

AAT

Methionine

M

ATG

 

A sequence may have several “reading frames” in which amino acid codons mapping interpretation may vary. Essentially, to read a sequence, you must first find a starting codon… otherwise; your sequence is the representation of nothing in biological life (real world!)

 

Another interesting aspect is that a specific DNA sequence (with ‘significant’ length) seems to represent one part of a global ‘predefined’ structure… that is, in a way, similar to a known melody in music. If you start to play the first specific notes of, say, a Beatles’ song, everyone can tell the rest of the melody. If your first notes are not specific enough, the result may lead to so many different melodies.

This phenomenon is used in PCR (Polymerase Chain Reaction) in molecular biology engineering to amplify or clone DNA sequences using partial sequences (rigorously selected!).        

 

Useful lessons for software design

Many (if not all J) real world problems seem to follow DNA sequences structure and representations:

§  Basic elements (A, T, G, C)

§  Related each to one another (AT, GC)

§  Composing a global sequence (unique for a specific area)

§  The sequence can be presented differently (DNA /Amino acid)

§  The translation between representations is done through specific mappings (codons / amino acids)

 

PCR technique also seems of great interest to some software areas (OCR recognition for example)

 

I will continue, in future posts, to explore these fascinating structures and propose some applications that mimic and benefit from their behaviors.

 

Back to basics: the Team vs. the Crew!

by Taoffi Nassar 13. July 2010 16:55

“If you don’t vent the drain pipe like this, sewage gases will seep-up through the water in the toilet, and the house will stink of shit”!

That seems to be a ‘clear standard’ taught to an apprentice.

Around such clear, understandable and concrete reasoning, you can build a product (or at least a knowledge) that is reusable and sustainable.

In his book “Shop Class As Soul Craft”, Matthew B. Crawford revisits the meaning, structure and alienation of Work and Knowledge in the modern era (particularly after World War II) and delivers a fresh and inspired view of the question.

One of the discussed subjects is the ‘Team’ rhetoric which appears to be the modern form for trying to definitively remove the individual from the image of ‘Work’.

 

“There is a sort of friendship or solidarity that becomes possible at work when people are open about differences of rank, and [where] there are clear standards.”